5 16 Gel Electrophoresis Ms Blalock Ms Hartsell

5 -16 Gel Electrophoresis Ms. Blalock, Ms. Hartsell, Mr. Luckman

Do Now What do restriction enzymes do to a DNA sample?

Restriction Enzymes Recognizes and cuts DNA only at a particular sequence of base pairs (ATGC)

Aim: How does Gel Electrophoresis help solve murder crimes? Agenda • • • Do Now Hook Activity 1: Introduction to Gel Electrophoresis Activity 2: Interactive Activity 3: Lab Report Part I – Background Information • Exit Ticket

Hook Video How can technology help solve murder mysteries? http: //vitalny. pbslearningmedia. org/asset/tdc 02 _vid_sheppard/

Gel Electrophoresis A technique used to show species are related to one another

Gel Electrophoresis Goal – Find a DNA match between two samples. Related organisms will show similar banding patterns because their DNA is the same

Gel Electrophoresis Goal – Find a DNA match between two samples. The DNA bands should have a similar pattern between identical species

Gel Electrophoresis Example – W = Blood at crime scene. X, Y, and Z are DNA samples of suspects

Gel Electrophoresis So how does this work?

Gel Electrophoresis So how does this work?

Step 1 – Obtain DNA samples

Step 2 – Add restriction Enzymes Restriction Enzymes split the DNA into particular lengths Example-- cuts at CC/GG Put a line where the enzyme would cut the DNA AGCTCCGGTCATGCCGGATGACTGATCCGGATA

Step 2 – Add restriction Enzymes Restriction Enzymes split the DNA into particular lengths Example-- cuts at CC/GG Put a line where the enzyme would cut the DNA AGCTCCGGTCATGCCGGATGACTGATCCGGATA

Step 2 – Add restriction Enzymes AGCTCCGGTCATGCCGGATGACTGATCCGGATA Separate pieces – based on length GGATA AGCTCC GGTCATGCC GGATGACTGATCC

Step 3 - DNA is placed in the wells DNA

Step 4 – Electricity is added - +

Step 5 – Observe Banding An electric current carries the DNA fragments through the gel, separating them according to size (smaller pieces of DNA are carried farther from the well than larger pieces) Large pieces GGATGACTGATCC Small pieces GGTCATGCC AGCTCC GGATA GGATGACTGATCC GGTCATGCC AGCTCC GGATA

Check for Understanding

Activity 2 Directions: 1. Go to www. fordhamarts. com 2. Living Environment 3. Unit 5 -Genetics 4. Interactive/Video 5. 5 -16 Gel Electrophoresis In groups, go through the interactive and answer the guiding questions in your notes ACTUALLY READ THE TEXT IN THE INTERACTIVE OR YOU WILL NOT LEARN http: //www. classzone. com/books/hs/ca/sc/bio_07/virtu al_labs/virtual. Labs. html

Activity 3 – Lab Introduction Directions: Read overview of lab report instructions • Over the next few days we will be working to solve a murder crime using Gel Electrophoresis. • Your end work product will be a typed lab report.

Activity 3 – Background Information • Look at an example background information section of a lab report • Look at the section of the rubric on background information What would you rate this example and why?

Activity 3 – Background Information Directions: Create your draft background information based on what you have learned today about Gel Electrophoresis. Create your draft on Google Drive 1. 2. 3. 4. 5. www. Google. com/drive Username: firstname. lastname@fhsaonline. org Password: ID number Click on “Create” -> Document Name the document “Firstname. Lastname. Gel. Electrophoresis. Lab 6. Use 12 font

Activity 3 – Finish Early? • Use the rubric to peer assess a neighbor’s background information

Exit Ticket